
Outer membrane compositions enhance the rate of extracellular electron transport via cell-surface

Moss PPR-SMR protein PpPPR_64 influences the expression of a psaA-psaB-rps14 gene cluster and processing of the 23S-4.5S rRNA precursor in chloroplasts

Moss PPR-SMR protein PpPPR_64 is a pTAC2 homolog but is functionally distinct from pTAC2. PpPPR_64 is required for psaA gene expression and its function may have evolved in mosses. The pentatricopeptide repeat (PPR) proteins are key regulatory factors responsible for the control of plant organellar gene expression. A small subset of PPR proteins possess a C-terminal small MutS-related (SMR) domain and have diverse roles in plant organellar biogenesis. However, the function of PPR-SMR proteins is not fully understood.

Here, we report the function of PPR-SMR protein PpPPR_64 in the moss Physcomitrium patens. Phylogenetic analysis indicated that PpPPR_64 belongs to the same clade as the Arabidopsis PPR-SMR protein pTAC2. PpPPR_64 knockout (KO) mutants grew autotrophically but with reduced protonemata growth and the poor formation of photosystems’ antenna complexes.

Quantitative reverse transcription-polymerase chain reaction and RNA gel blot hybridization analyses revealed a significant reduction in transcript levels of the psaA-psaB-rps14 gene cluster but no alteration to transcript levels of most photosynthesis- and non-photosynthesis-related genes.

In addition, RNA processing of 23S-4.5S rRNA precursor was impaired in the PpPPR_64 KO mutants. This suggests that PpPPR_64 is specifically involved in the expression level of the psaA-psaB-rps14 gene and in processing of the 23S-4.5S rRNA precursor. Our results indicate that PpPPR_64 is functionally distinct from pTAC2 and is a novel PPR-SMR protein required for proper chloroplast biogenesis in P. patens.

Outer membrane compositions enhance the rate of extracellular electron transport via cell-surface MtrC protein in Shewanella oneidensis MR-1

While cell membrane composition is critical for the function of membrane proteins, membrane modification has not been used to control the rate of extracellular electron transfer (EET) via the outer membrane protein complexes. Here, the rate of electron flow via the cell-surface redox protein, MtrC, was highly enhanced upon change in the outer membrane composition in Shewanella oneidensis MR-1.
The MR-1 strain was pre-cultured at 4 °C and 30 °C to initiate differentiation of membrane composition. The whole-cell difference electrochemical assay of wild-type and mutant strains lacking MtrC suggested that the rate of EET via MtrC increased approximately 18 times at 4 °C than 30 °C.
Circular dichroism spectroscopy showed that the molar exciton coupling coefficient for inter-heme interaction in MtrC increased in MR-1 at 4 °C than 30 °C. Results suggest that membrane modification may be a novel strategy for improving the efficiency of EET-based technologies.

Leucine-rich alpha-2 glycoprotein (LRG): A novel acute phase protein expressed in stage 3 grade C periodontitis before and after periodontal therapy


Background: Leucine-rich alpha-2 glycoprotein (LRG) is a novel acute phase protein involved in inflammation-associated diseases and that considered to be induced by multiple proinflammatory cytokines.
This study aimed to investigate gingival crevicular fluid (GCF) and serum levels of LRG, interleukin (IL)-6 and tumor necrosis factor (TNF)-α in patients with stage 3 periodontitis before and after non-surgical periodontal treatment.
Methods: Twenty-five stage 3 periodontitis and twenty-five periodontally healthy individuals were enrolled in the study. Clinical periodontal measurements were recorded; periodontitis patients received non-surgical periodontal treatment, and GCF and serum samples were obtained at baseline and at 6 weeks after treatment. LRG, IL-6 and TNF-α were determined by ELISA.
Results: GCF and serum LRG, IL-6 and TNF-α were significantly higher in periodontitis group than healthy controls (P < 0.001). A significant decrease in GCF and serum LRG, IL-6 and TNF-α was detected after periodontal treatment compared to baseline values of periodontitis patients (P < 0.001).
Conclusion: Our findings revealed that LRG expression was increased in stage 3 periodontitis both locally and systemically, and non-surgical periodontal therapy was effective in reducing LRG levels in GCF and serum of these patients. This article is protected by copyright. All rights reserved.

Aqueous Two-Phase-Assisted Precipitation of Proteins: A Platform for Isolation of Process-Related Impurities from Therapeutic Proteins

Aqueous two-phase systems (ATPS) have been widely and successfully used in the purification of various biological macromolecules such as proteins, nucleic acids, antibiotics, and cell components.
Interfacial precipitation of the product often results in lower recovery and selectivity of ATPS. Efficient resolubilization of the interfacial precipitate offers a way to improve the recovery as well as selectivity of ATPS systems.

Tyrosyl-DNA Phosphodiesterase 2 (TDP2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosyl-DNA Phosphodiesterase 2 (TDP2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosyl-Dna Phosphodiesterase 1 (TDP1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

abx029686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

abx029686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

abx433352-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

abx238572-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Tyrosyl DNA Phosphodiesterase 1 (TDP1)

  • EUR 395.68
  • EUR 209.00
  • EUR 1208.80
  • EUR 469.60
  • EUR 839.20
  • EUR 328.00
  • EUR 2872.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8BJ37
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tyrosyl DNA Phosphodiesterase 1 expressed in: E.coli

Recombinant Tyrosyl DNA Phosphodiesterase 1 (TDP1)

  • EUR 404.64
  • EUR 211.00
  • EUR 1242.40
  • EUR 480.80
  • EUR 861.60
  • EUR 334.00
  • EUR 2956.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q4G056
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.4kDa
  • Isoelectric Point: 7.1
Description: Recombinant Rat Tyrosyl DNA Phosphodiesterase 1 expressed in: E.coli

Human Tyrosyl- DNA phosphodiesterase 2, TDP2 ELISA KIT

ELI-16782h 96 Tests
EUR 824

Bovine Tyrosyl- DNA phosphodiesterase 2, TDP2 ELISA KIT

ELI-17055b 96 Tests
EUR 928

Mouse Tyrosyl- DNA phosphodiesterase 2, Tdp2 ELISA KIT

ELI-51300m 96 Tests
EUR 865

TDP2 Tyrosyl-DNA Phosphodiesterase 2 Human Recombinant Protein

PROTO95551 Regular: 10ug
EUR 317
Description: TDP2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 385 amino acids (1-362) and having a molecular mass of 43.3kDa. ;TDP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1) Protein

  • EUR 565.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 662.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody

31298-05111 150 ug
EUR 261

Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Tyrosyl- DNA phosphodiesterase 1, Tdp1 ELISA KIT

ELI-44743m 96 Tests
EUR 865

Human Tyrosyl- DNA phosphodiesterase 1, TDP1 ELISA KIT

ELI-39932h 96 Tests
EUR 824

Human Tyrosyl-DNA Phosphodiesterase 1(TDP1)ELISA Kit

CSB-E17810h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tyrosyl-DNA Phosphodiesterase 1 (TDP1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tyrosyl-DNA Phosphodiesterase 1(TDP1)ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tyrosyl-DNA Phosphodiesterase 1(TDP1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

TDP1 Tyrosyl-DNA Phosphodiesterase 1 Human Recombinant Protein

PROTQ9NUW8 Regular: 20ug
EUR 317
Description: TDP1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 318 amino acids (1-298) and having a molecular mass of 35.8kDa. TDP1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TDP1 (Glu4~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1)

Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) ELISA Kit

SEC785Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) ELISA Kit

SEC785Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) ELISA Kit

SEC785Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) ELISA Kit

SEC785Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tyrosyl DNA Phosphodiesterase 1 elisa. Alternative names of the recognized antigen: SCAN1
  • Tyr-DNA phosphodiesterase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tyrosyl DNA Phosphodiesterase 1 (TDP1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Tyrosyl-DNA Phosphodiesterase 1 (TDP1) Antibody (Biotin Conjugate)

31298-05121 150 ug
EUR 369

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TDP1 (Glu4~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1). This antibody is labeled with APC.

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TDP1 (Glu4~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1). This antibody is labeled with Biotin.

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TDP1 (Glu4~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1). This antibody is labeled with Cy3.

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TDP1 (Glu4~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1). This antibody is labeled with FITC.

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TDP1 (Glu4~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1). This antibody is labeled with HRP.

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TDP1 (Glu4~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1). This antibody is labeled with PE.

Human Tyrosyl-DNA Phosphodiesterase 1 (TDP1) AssayLite Antibody (FITC Conjugate)

31298-05141 150 ug
EUR 428

Human Tyrosyl-DNA Phosphodiesterase 1 (TDP1) AssayLite Antibody (RPE Conjugate)

31298-05151 150 ug
EUR 428

Human Tyrosyl-DNA Phosphodiesterase 1 (TDP1) AssayLite Antibody (APC Conjugate)

31298-05161 150 ug
EUR 428

Human Tyrosyl-DNA Phosphodiesterase 1 (TDP1) AssayLite Antibody (PerCP Conjugate)

31298-05171 150 ug
EUR 471

TDP1 Human, Tyrosyl-DNA Phosphodiesterase 1 Human Recombinant Protein, Sf9

PROTQ9NUW8-1 Regular: 5ug
EUR 317
Description: TDP1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 617 amino acids (1-608) and having a molecular mass of 69.5kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TDP1 is fused to 9 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques. 

Tyrosyl DNA Phosphodiesterase 1 (TDP1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TDP1 (Glu4~Gln215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tyrosyl DNA Phosphodiesterase 1 (TDP1). This antibody is labeled with APC-Cy7.


M-DNA-100BP 1/pk
EUR 73
Description: Bioscience Mol Bio; DNA Ladder


M-DNA-1KB 1/pk
EUR 70
Description: Bioscience Mol Bio; DNA Ladder

Tyrosyl-tRNA synthetase 2 (Recombinant)

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Kinetoplast DNA (catenated)

TG2013-2 50 ug
EUR 380

Supercoiled pHOT-1 DNA

TG2030-2 50 ug
EUR 324

Relaxed pHOT-1 DNA

TG2035-2 50 ug
EUR 347

D-Tyrosyl-tRNA Deacylase 2 (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Anti-DNA Polymerase lambda/POLL Antibody

A00959-2 100ug/vial
EUR 294

pRYG DNA (topo II target site)

TG2023-2 20 ug
EUR 302

500-10000bp DNA Marker, Original Form

M101O-2 5x100loading, 500prep
EUR 219.65
  • Product category: Electrophoresis Related/Ladders - DNA/500-10000 bp

100-1500bp DNA Marker, Original Form

M102O-2 5x100loading, 500prep
EUR 215.3
  • Product category: Electrophoresis Related/Ladders - DNA/100-1500 bp

100-1500bp DNA Marker, Original Form

M107O-2 5x100loading, 500prep
EUR 219.65
  • Product category: Electrophoresis Related/Ladders - DNA/100-1500 bp

Tyrosyl-tRNA Synthetase 2, Mitochondrial (YARS2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Topoisomerase I Assay Kit (62.5ug SC DNA)

TG1015-2 250 assays
EUR 414

500-10000bp DNA Marker, Ready-to-use

M101R-2 5x100loading, 500prep
EUR 219.65
  • Product category: Electrophoresis Related/Ladders - DNA/500-10000 bp

100-1500bp DNA Marker, Ready-to-use

M102R-2 5x100loading, 500prep
EUR 215.3
  • Product category: Electrophoresis Related/Ladders - DNA/100-1500 bp

Lambda DNA/HindIII Marker, Ready-to-use

M104R-2 5x100loading, 500prep
EUR 124.82
  • Product category: Electrophoresis Related/Ladders - DNA/Lambda DNA/HindIII

Lambda DNA/HindIII Plus, Ready-to-use

M105R-2 5x100loading, 500prep
EUR 115.25
  • Product category: Electrophoresis Related/Ladders - DNA/Lambda DNA/HindIII

100-1500bp DNA Marker, Ready-to-use

M107R-2 5x100loading, 500prep
EUR 219.65
  • Product category: Electrophoresis Related/Ladders - DNA/100-1500 bp

Tyrosyl-tRNA synthetase (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Anti-DNA-topoisomerase II α Monoclonal Antibody (1C5)

M00953-2 100ug
EUR 420
Description: Mouse Monoclonal DNA-topoisomerase II α Antibody (1C5). Validated in Flow Cytometry, IP, IF, IHC, WB and tested in Human.

Topoisomerase II Drug Screening Kit (62.5ug SC DNA)

TG1009-2 250 assays
EUR 470

Topoisomerase I Drug Screening Kit (62.5ug SC DNA)

TG1018-2 250 assays
EUR 448

YARS2 Tyrosyl-tRNA Synthetase 2 Human Recombinant Protein

PROTQ9Y2Z4 Regular: 10ug
EUR 317
Description: YARS2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 482 amino acids (17-477 a.a.) and having a molecular mass of 53.7kDa.;YARS2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Sphingomyelin Phosphodiesterase 2 (SMPD2) Antibody

abx117048-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Sphingomyelin Phosphodiesterase 2 (SMPD2) Antibody

abx122431-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Sphingomyelin Phosphodiesterase 2 (SMPD2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sphingomyelin phosphodiesterase 2 (SMPD2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Genomic DNA from hypertension: Artery, from a single donor

D1236013Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from hypertension: Vein, from a single donor

D1236020Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from hypertension: Heart, from a single donor

D1236122Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from hypertension: Kidney, from a single donor

D1236142Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from Bronchitis: Lung, from a single donor

D1236152Ld-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from hypertension: Interventricular Septum, from a single donor

D1236130Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

E. coli Topoisomerase IV Drug Screening Kit (62.5ug SC DNA)

TG1007-2 250 assays
EUR 448

Tyrosyl tRNA Synthetase (YARS) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tyrosyl tRNA Synthetase (YARS) Antibody

abx122273-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tyrosyl-tRNA Synthetase (YARS) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosyl tRNA Synthetase (YARS) Antibody

abx033489-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosyl tRNA Synthetase (YARS) Antibody

abx033489-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosyl tRNA Synthetase (YARS) Antibody

abx033490-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosyl tRNA Synthetase (YARS) Antibody

abx033490-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosyl tRNA Synthetase (YARS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Human Tyrosyl-tRNA Synthetase

7-03811 2µg Ask for price

Recombinant Human Tyrosyl-tRNA Synthetase

7-03812 10µg Ask for price

Recombinant Human Tyrosyl-tRNA Synthetase

7-03813 1mg Ask for price

Recombinant Tyrosyl tRNA Synthetase (YARS)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P54577
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 62.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tyrosyl tRNA Synthetase expressed in: E.coli

Anti-Tyrosyl tRNA synthetase (2F3)

YF-MA16427 50 ug
EUR 363
Description: Mouse monoclonal to Tyrosyl tRNA synthetase

Anti-Tyrosyl tRNA synthetase (2F3)

YF-MA16428 200 ul
EUR 363
Description: Mouse monoclonal to Tyrosyl tRNA synthetase

Genomic DNA from hypertension: Heart Atrium, left, from a single donor

D1236126Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from hypertension: Heart Atrium, right, from a single donor

D1236127Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from hypertension: Heart Ventricle, left, from a single donor

D1236138Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Genomic DNA from hypertension: Heart Ventricle, right, from a single donor

D1236139Hd-2 50 ug
EUR 446
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

100 bp-10 Kb Wide Range DNA Logical Marker, Original Form

M103O-2 5x100loading, 500prep
EUR 363.2
  • Product category: Electrophoresis Related/Ladders - DNA/100-10000 bp

Human Probable D-tyrosyl-tRNA (Tyr) deacylase 2 (DTD2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Probable D-tyrosyl-tRNA(Tyr) deacylase 2(DTD2) expressed in E.coli

DTD2 D-Tyrosyl-tRNA Deacylase 2 Human Recombinant Protein

PROTQ96FN9 Regular: 20ug
EUR 317
Description: DTD2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 191 amino acids (1-168) and having a molecular mass of 21.0 kDa. DTD2 is fused to a 23 amino acid His-tag at N-terminus.

Azura PureView 250bp DNA Ladder - 1000 Lanes

AZ-1125-2 1000 Lanes
EUR 272

Azura PureView 100bp DNA Ladder - 1000 Lanes

AZ-1135-2 1000 Lanes
EUR 272

Azura PureView 50bp DNA Ladder - 1000 Lanes

AZ-1155-2 1000 Lanes
EUR 272

Plant Genomic DNA Extraction Mini Kit (200prep)

FAPGK-001-2 200 preps
EUR 274

Rabbit Ectonucleotide Pyrophosphatase/ Phosphodiesterase 2 ELISA

ELA-E1228Rb 96 Tests
EUR 928

Ectonucleotide Pyrophosphatase/Phosphodiesterase 2 (ENPP2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ectonucleotide Pyrophosphatase/Phosphodiesterase 2 (ENPP2) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
In this protocol, we describe a method for aqueous two-phase-assisted precipitation and resolubilization of the recombinant human Granulocyte Colony Stimulating Factor (GCSF) for its selective isolation from E. coli host cell proteins as well as nucleic acids.
This platform purification can be applied to other cytokines as well as most of the hydrophobic proteins that partition into the hydrophobic PEG-rich top phase. Recoveries of up to 100% of the product along with reduction of levels of E. coli host cell proteins (from 250-500 to 10-15 ppm) and of nucleic acids (from 15-20 to 5-15 ng/mL) were observed.

Affinity Tags in Protein Purification and Peptide Enrichment: An Overview

The reversible interaction between an affinity ligand and a complementary receptor has been widely explored in purification systems for several biomolecules. The development of tailored affinity ligands highly specific toward particular target biomolecules is one of the options in affinity purification systems.
However, both genetic and chemical modifications in proteins and peptides widen the application of affinity ligand-tag receptors pairs toward universal capture and purification strategies.
In particular, this chapter will focus on two case studies highly relevant for biotechnology and biomedical areas, namely the affinity tags and receptors employed on the production of recombinant fusion proteins, and the chemical modification of phosphate groups on proteins and peptides and the subsequent specific capture and enrichment, a mandatory step before further proteomic analysis.

Synthetic Ligand Affinity Chromatography Purification of Human Serum Albumin and Related Fusion Proteins

Synthetic ligand affinity adsorbents offer an efficient means for purification of biopharmaceuticals. Single-isomer textile dye C.I. Reactive Blue and newer ligands developed by rational design and screening of chemical combinatorial libraries based on a triazine scaffold are routinely used for the capture and purification of these proteins from engineered recombinant expression systems.
Here, we describe methods for the purification of recombinant human serum albumin and related fusion proteins using synthetic ligand affinity adsorbents.

Redox homeostasis and cell cycle activation mediate beta-cell mass expansion in aged, diabetes-prone mice under metabolic stress conditions: Role of thioredoxin-interacting protein (TXNIP)


Overnutrition contributes to insulin resistance, obesity and metabolic stress, initiating a loss of functional beta-cells and diabetes development. Whether these damaging effects are amplified in advanced age is barely investigated.
Therefore, New Zealand Obese (NZO) mice, a well-established model for the investigation of human obesity-associated type 2 diabetes, were fed a metabolically challenging diet with a high-fat, carbohydrate restricted period followed by a carbohydrate intervention in young as well as advanced age.
Interestingly, while young NZO mice developed massive hyperglycemia in response to carbohydrate feeding, leading to beta-cell dysfunction and cell death, aged counterparts compensated the increased insulin demand by persistent beta-cell function and beta-cell mass expansion.
Beta-cell loss in young NZO islets was linked to increased expression of thioredoxin-interacting protein (TXNIP), presumably initiating an apoptosis-signaling cascade via caspase-3 activation. In contrast, islets of aged NZOs exhibited a sustained redox balance without changes in TXNIP expression, associated with higher proliferative potential by cell cycle activation.
These findings support the relevance of a maintained proliferative potential and redox homeostasis for preserving islet functionality under metabolic stress, with the peculiarity that this adaptive response emerged with advanced age in diabetes-prone NZO mice.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GTPBP8 Rabbit pAb
A16189-100ul 100 ul
EUR 308
GTPBP8 Rabbit pAb
A16189-200ul 200 ul
EUR 459
GTPBP8 Rabbit pAb
A16189-20ul 20 ul
EUR 183
GTPBP8 Rabbit pAb
A16189-50ul 50 ul
EUR 223
GTPBP8 Polyclonal Antibody
29768-100ul 100ul
EUR 252
GTPBP8 Polyclonal Antibody
29768-50ul 50ul
EUR 187
GTPBP8 cloning plasmid
CSB-CL818697HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
GTPBP8 cloning plasmid
CSB-CL818697HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 855
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
Anti-GTPBP8 antibody
STJ118642 100 µl
EUR 277
GTPBP8 Polyclonal Conjugated Antibody
C29768 100ul
EUR 397
Mouse GTPBP8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat GTPBP8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GTPBP8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GTPBP8 Recombinant Protein (Human)
RP014239 100 ug Ask for price
GTPBP8 Recombinant Protein (Human)
RP014242 100 ug Ask for price
GTPBP8 Recombinant Protein (Rat)
RP203999 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140480 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140483 100 ug Ask for price
GTPBP8 ORF Vector (Human) (pORF)
ORF004747 1.0 ug DNA
EUR 95
GTPBP8 ORF Vector (Human) (pORF)
ORF004748 1.0 ug DNA
EUR 95
Gtpbp8 ORF Vector (Rat) (pORF)
ORF068001 1.0 ug DNA
EUR 506
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046828 1.0 ug DNA
EUR 506
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046829 1.0 ug DNA
EUR 506
cDNA Synthesis SuperMix
  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
Evo? cDNA Kit
EUR 294
Evo? cDNA Kit
EUR 234
Novo? cDNA Kit
EUR 354
Novo? cDNA Kit
EUR 267
Evo? cDNA Supermix
EUR 381
Evo? cDNA Supermix
EUR 267
Novo? cDNA Supermix
EUR 441
Novo? cDNA Supermix
EUR 289
GTPBP8 sgRNA CRISPR Lentivector set (Human)
K0919501 3 x 1.0 ug
EUR 339
Gtpbp8 sgRNA CRISPR Lentivector set (Mouse)
K4112501 3 x 1.0 ug
EUR 339
Gtpbp8 sgRNA CRISPR Lentivector set (Rat)
K7385901 3 x 1.0 ug
EUR 339
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 40 reactions
EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
  • EUR 620.00
  • EUR 523.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
  • EUR 871.00
  • EUR 662.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.
cDNA Probe Diluent Solution
AR0063 5mL
EUR 106
Tetro cDNA Synthesis Kit
BIO-65042 30 Reactions Ask for price
Tetro cDNA Synthesis Kit
BIO-65043 100 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053 50 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053/S Sample Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65054 250 Reactions Ask for price
cDNA from Arteriosclerosis: Aorta
C1236012Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Artery
C1236013Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Arteriosclerosis: Artery
C1236013Hd-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Vein
C1236020Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Colon
C1236090Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Heart
C1236122Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Heart
C1236122Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Kidney
C1236142Hd-2 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Kidney
C1236142Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Liver
C1236149Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Asthma: Lung
C1236152Ld-1 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Bronchitis: Lung
C1236152Ld-2 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Emphysema: Lung
C1236152Ld-3 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Pneumonia: Lung
C1236152Ld-4 40 reactions
EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Lung
C1236152Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Pancreas
C1236188Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Spleen
C1236246Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: stomach
C1236248Lup 40 reactions
EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
OneScriptPlus cDNA Synthesis Kit
G235 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis Kit
G236 100 x 20 ul reactions
EUR 169
OneScriptPlus cDNA Synthesis SuperMix
G453 25 x 20 ul reactions
EUR 97
OneScriptPlus cDNA Synthesis SuperMix
G454 100 x 20 ul reactions
EUR 169
circRNA cDNA Synthesis Kit
G627 25 rxn (20 ul/rxn)
EUR 309
Human eNOS cDNA probe
eNOS51-D-2 2 ug
EUR 445
Plant Tissue cDNA: Arabidopsis
PC34-310 10 rxn
EUR 415
Novo? Transcriptome cDNA Kit
EUR 952
Novo? Transcriptome cDNA Kit
EUR 441
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0919502 1.0 ug DNA
EUR 154
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0919503 1.0 ug DNA
EUR 154
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0919504 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4112502 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4112503 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4112504 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7385902 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7385903 1.0 ug DNA
EUR 154
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7385904 1.0 ug DNA
EUR 154
GTPBP8 Protein Vector (Rat) (pPB-C-His)
PV272002 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPB-N-His)
PV272003 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPM-C-HA)
PV272004 500 ng
EUR 603
GTPBP8 Protein Vector (Rat) (pPM-C-His)
PV272005 500 ng
EUR 603
GTPBP8 Protein Vector (Human) (pPB-C-His)
PV018985 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPB-N-His)
PV018986 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPM-C-HA)
PV018987 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPM-C-His)
PV018988 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPB-C-His)
PV018989 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPB-N-His)
PV018990 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPM-C-HA)
PV018991 500 ng
EUR 329
GTPBP8 Protein Vector (Human) (pPM-C-His)
PV018992 500 ng
EUR 329

Leave a Reply

Your email address will not be published. Required fields are marked *